>> www.barakaldodigital.com tiene licencia creative commons. Puedes copiar y distribuir nuestras noticias, pero señala de dónde las has tomado
Barakaldodigital.com

Inicio | Denuncias vecinales | Bienestar | Cultura | Economía | Política | Teatro Barakaldo | Balonmano Zuazo | Barakaldo CF | baloncesto | fútbol | balonmano | fiestas | publicidad@barakaldodigital.com | redaccion@barakaldodigital.com | Quiénes somos | RSS | Tarifas de publicidad

El hospital de Cruces da el alta al varón de 57 años agredido a patadas en Arteagabeitia

La víctima, en el suelo tras el ataque
 El agresor quedó en libertad tras declarar, a la espera de juicio La víctima sufrió al media docena golpes en la zona de la cabeza parte de ellos mientras yacía en apariencia inconsciente
El hospital de Cruces ha informado de que ha dado el alta, este 9 de abril, al vecino de Barakaldo de 57 años que sufrió una agresión patadas el fin de semana en el barrio de Arteagabeitia. El varón fue golpeado de manera repetida en la cabeza por un individuo de 35 años en el curso de una discusión que testigos presenciales han informado de que se produjo por los perros. Un vídeo del altercado muestra que ambos llevaban sus mascotas consigo, aunque la víctima lo tenía con correa y el agresor suelto. El atacante fue detenido por la Policía Municipal y puesto a disposición judicial, tras lo que quedó en libertad a la espera de juicio.

Archivo |
> 08/04/2017. Una pelea por los perros acaba con un herido en el hospital y el agresor detenido

24 comentarios:

  1. Como se puede llegar a tal extremo por unos perracos, de verdad, no tiene explicacion , pero los perrunos, de esos trabajos malos, con otros animales hay bastante gente pòr no decir todos que los llevan sueltos, y ellos con boca abierta de rica, no me gustan esos gestos por buenos que sean, impuestos a esos animales por mil, por la peligrisidad de las personas humanas, y de otros animales de su especie pero de otro aspecto mas normal, que no den miedo, por lo que puedan pasar, y la seguridad ciudadana no hace nada nunca he visto, llamar la atencion , a los que acompañan a los ladradores, convulsivos, GGGGGUUUUUUUUUUAAAAAAAAUUUUU

    ResponderEliminar
    Respuestas
    1. Uuuyyyyyyyyy.. !!!!! Lo que ha dicho.

      Eliminar
    2. Pues en este caso el peligroso parece que no era el perro....

      Eliminar
  2. Ha pasado mas tiempo el agredido en elhospital que el agresor en dependencias policiales.LAMENTABLE

    ResponderEliminar
  3. ESTA ES LA JUSTICIA QUE TENEMOS???? ESE INDIVIDUO DEBERIA ESTAR EN LA CARCEL EL RESTO DE SU VIDA.

    ResponderEliminar
    Respuestas
    1. ¿Un poquito ya te has pasado no?
      Bastaria con darle su misma medicina. Un tio que le doble en fuerza y juventud y a ver si es tan valiente.

      Eliminar
  4. Y se puede saber como empezó y quien tuvo la culpa??

    ResponderEliminar
    Respuestas
    1. Este buen señor ha sido apaleado por hacer lo que la policia deberia de hacer a diario y no hace, instar al agresor a atar al perro como dice la normativa municipal:
      "Antonio es un vecino de Barakaldo de 53 años que estaba harto de no poder pasear tranquilo con su perro porque otro joven de la localidad sacaba al suyo, de una raza considerada como potencialmente peligrosa, sin correa y sin bozal. Su conducta fue motivo de constantes discusiones que desembocaron el pasado sábado por la noche en una cruenta pelea que le llevó a recibir hasta diez patadas en la cabeza, tal y como se puede ver en un vídeo que pone los pelos de punta por su violencia"
      http://www.elcorreo.com/bizkaia/margen-izquierda/201704/09/brutal-agresion-joven-hombre-20170409002249.html

      Eliminar
    2. Está claro, la culpa es de la persona que está en el suelo, que golpea salvajemene con su cabeza el pie de la pobre víctima una y otra vez sin ningún tipo de compasión.

      Eliminar
    3. Ese es el problema , la gente que justifica la violencia , como tu

      Eliminar
    4. ¿La culpa de qué? Aquí no hay culpas: aqui hay un agresor y un agredido.

      Eliminar
  5. Me parece tan absurdo que tengáis que a primer imagen, critiqueis al chaval que esta pegando, ai que saber la historia desde él principio no solo lo que se graba, Y ATILA ES EL PERRO MAS BUENO QUE PUEDE HABER ASIQUE NI LO MENCIONES TANTA MIERDA QUE SI BOZAL QUE SI PERRO PELIGROSA PERO DE QUE VAIS?????? MIRAR HABER SI LOS PERROS PEQUEÑOS SON LOS PEORES, y mirar también si los perros del herido eran quienes tocaban los cojines a atila cobardes antes de criticar y insultar, aprendería bien la historia.

    ResponderEliminar
    Respuestas
    1. ATILA QUE NOMBRE MAS BUENO ,ESE NOMBRE DEBE SER DE ALGUN SANTO, TODABIA NO CANONIZADO, POR ESTE CAMINO LLEGARA PRONTO, ENCIMA UNA RATA LE TOCABA LO QUE TIENE COLGANDO, ES DEMASIADO, CON ESE NOMBRE Y LUEGO QUE LE TOQUE LAS PARTES INTIMAS DE REPRODUCION , NO ES TOLERABLE ESE COMPORTAMIENTO POR PARTE, DE LA MASCOTILLA,
      PERO LOS AMOS DE LOS CUADRUPEDOS, PEGANDOSE, NO HAY PELEA SI UNO NO QUIERE, NO ES SEA UNA REALIDAD PERO EL TIEMPO ASI LO HA HECHO, PARA PEGARSE TIENE QUE HABER DOS UNO EN FRENTE DE OTRO,

      EL RESTO SALVESE QUIEN PUEDA,PERO PEGAR A UNA PERSONA EN EL SUELO, ES DE UNA PERSONA SIN SENTIMIENTOS ALGUNO HACIA LOS HUMANOS, UN SALVAJE DE SELVA, QUE CUANDO TIENEN HAMBRE SE COMEN AL VECINO. NO LE IMPORTA CALIDAD , NI ESPECIE, SOLO QUEDAR SATISFECHO CON LA COMIDA.

      Eliminar
    2. Si Atila " el perro más bueno del mundo" hubiera llevado su correa y su bozal este episodio se hubiera ahorrado, puesto que es un perro de raza peligrosa. Otra cosa es si la ley está bien hecha o no pero de momento la que hay hay que cumplirla. Y no hace falta que grabé desde el principio con solo ver las paradas que pega en la cabeza a una persona inconsciente esa joyita de persona me vale.

      Eliminar
    3. Y encima se llama Atila...

      Eliminar
    4. "Criticar al chaval sin saber la historia" ¿De qué hablas? ¿Qué tiene que ver la historia, el perro, las disputas verbales y lo demás, si ya vemos su brutal comportamiento, totalmente incalificable? Un mal golpe hubiera acabado con su vida, aunque el "angelito" hubiera tenido razón en su disputa. No tienes un ápice de sentido común si justificas algo de lo que ha hecho tu amigo.

      Eliminar
  6. La culpa?
    Seguro que el caniche atado del hombre de 57 atacó al pitbull y el pobre chaval de 37 se defendió como pudo, al temer que su perro se le escapara asustado ante el ataque del caniche.

    ResponderEliminar
    Respuestas
    1. antes de decir sandeces.. como siempre.. informate bien pq la historia viene de atras...muy atras.. y no se si este panfleto seguira la historia... pero vendran mas cosas de esta historia e igual te sorprenderas.... tanto uno lo hace pesisimo como el otro...y no es como lo cuentan... hay que saber las dos versiones la de uno y la del otro... pero ante todo lo que hace el chaval es de carcel... pero tb hay mas cosas de atras..y ese perro no hace daño ni a una mosca...

      Eliminar
    2. Car te estas liando, los perros, son lo que animales pero las personas aunque vengan de nacimiento, y lo pongas mas atras, es motivo del discurso, que nos ha hechado.

      Eliminar
  7. Perdona,Atila es el perro o el dueño?

    ResponderEliminar
  8. Ah claro,como el perro le tocaba los cojines a Atila,pateo al dueño.Supongo que tu eres otro que haria lo mismo.Asi nos va con justicieros descerebrados

    ResponderEliminar
  9. Lo de Barakaldo y los perros peligrosos no tienen nombre. Estoy harto de ver perros peligrosos sueltos en parques infantiles.... y visto esto cualquiera dice algo al dueño.
    Me pregunto para que esta la policia municipal...si hay una normativa de bocales y correas no debería hacerla cumplir?

    ResponderEliminar
    Respuestas
    1. Ni un policía multando por las heces que dejan por ahi y tampoco por llevar los perros sin correas ( que aunque no sea de raza peligrosa también tienen que llevarlas)

      Eliminar
  10. Ya apareció 'carlos',a ponernos al.corriente de la historia y casi justificando la.agresión ,patético

    ResponderEliminar